What is Coding: Definition and 176 Discussions

Coding theory is the study of the properties of codes and their respective fitness for specific applications. Codes are used for data compression, cryptography, error detection and correction, data transmission and data storage. Codes are studied by various scientific disciplines—such as information theory, electrical engineering, mathematics, linguistics, and computer science—for the purpose of designing efficient and reliable data transmission methods. This typically involves the removal of redundancy and the correction or detection of errors in the transmitted data.
There are four types of coding:
Data compression (or source coding)
Error control (or channel coding)
Cryptographic coding
Line codingData compression attempts to remove redundancy from the data from a source in order to transmit it more efficiently. For example, ZIP data compression makes data files smaller, for purposes such as to reduce Internet traffic. Data compression and error correction may be studied in combination.
Error correction adds extra data bits to make the transmission of data more robust to disturbances present on the transmission channel. The ordinary user may not be aware of many applications using error correction. A typical music compact disc (CD) uses the Reed–Solomon code to correct for scratches and dust. In this application the transmission channel is the CD itself. Cell phones also use coding techniques to correct for the fading and noise of high frequency radio transmission. Data modems, telephone transmissions, and the NASA Deep Space Network all employ channel coding techniques to get the bits through, for example the turbo code and LDPC codes.

View More On Wikipedia.org
Recent contents Top users
  1. J

    What Coding Language Should I learn?

    Unlike some of my friends my knowledge of computing is very limited. I want to become a physicist, but I think it would be beneficial for me to learn how to code. However, after some research I am not sure what coding language to learn. What is the most useful / practical code that physicists...
  2. O

    Ternary Operations outside of coding?

    I use the ternary operation in web development all the time, eg: x = y > z ? a : b Which reads, if x > y then a, otherwise b I realize that it is just a shorthand for if...else statements, but even still, are there any mathematical properties associated with it? I know inequalities have...
  3. M

    LInear algebra coding question

    Homework Statement Describe how to create a coding matrix A so that A-1 has no fractions The answer is Multiply a few type III matrices together, so that det A = 1 What I put is to just use an upper triangular matrix, since the det of an upper triangular matrix is 1 and you have to do...
  4. B

    Help in a channel coding question

    Homework Statement Consider a particular channel coder that has a generator matrix G =[1 1 1 1 1] 1 -Generate all the allowable codewords for c . What do you think this code is called? 2- What is the minimum distance for this codeword? Describe how it might work to correct errors. Homework...
  5. G

    Modifying Future Value Program with a Python GUI

    Homework Statement To modify a future value program so that a user inputs the data w/ a GUI Homework Equations principal = principal * (1+apr) The Attempt at a Solution Anyone familiar w/ python coding? I'm a beginner. I'm absolutely stuck on this problem, I seem to have...
  6. A

    Levenberg marquardt C coding algorithm

    HI guys. Haven't been here in a while... I have an algorithm attached that uses the levenberg marquardt non linear curve fitting alogrithm to fit a surface. My C coding skills are reasonable, however I am struggling to adjust the model so that I can fit my curve to it. I want to use this...
  7. J

    Prevent memory leakage from coding

    I am studying a problem releated to memory leakage. Now, there are many tools to check memory leak at run-time (dynamic analysis), and some tools can check memory leakage at compile-time (static analysis). But I have some questions: How do you think to prevent memory leakage from coding phase...
  8. H

    Coding Theory. It also combine some linear algebra as well.

    Hi Guys I just got some problem about coding theory and I don't quite understand what question 2 is asking. Can you guys help me? Thanks a lot.
  9. M

    C/C++ [C++] coding a quadratic root finder with if statements

    [C++] coding a quadratic root finder with "if statements" //This program solves the qudratic equation #include <iostream> #include<cmath> #include<iomanip> using namespace std; int main() { //Declaring Varibles double coefA; double coefB; double coefC; double x1; double x2; double x3...
  10. S

    Comp Sci Solve Basic C++ Coding Challenges with Easy Steps

    Basic C++ Coding? Assume that name and age have been declared suitably for storing names (like "Abdullah", "Alexandra" and "Zoe") and ages respectively. Write some code that reads in a name and an age and then prints the message "The age of NAME is AGE." where NAME and AGE are replaced by the...
  11. dexterdev

    Can I get a circuit to realize manchester coding and decoding

    Hi all, Can I get a circuit to realize manchester coding and decoding using ordinary digital TTL ICs and comparators. Any link or image will be helpful. TIA -Devanand T
  12. D

    A problem with coding in 8085 microprocessor

    After i had studied and implemented codes to perform basic arithematic operations, factorial of a number, look-up tables, i got stuck at a pretty silly problem, while coding with the 80085 simulator: MVI A,000H STA 0001H MVI A,0001H STA 0002H LXI H,0001H MOV A,M LXI B,0002H STAX B HLT This...
  13. T

    Huffman coding a Markov source

    Suppose you have a Markov source of symbols (or more generally, a stationary ergodic source). If you Huffman encode longer and longer extensions (that is, you take blocks of n source symbols at a time, letting n increase) of this source, then the frequencies of 1's and 0's in the encoded...
  14. S

    How Do You Update Position, Transform Points, and Render Shapes in Programming?

    help needed please.. don't need the code. but i need formula or any source that can help me. i want to try code it myself. =) can anyone help me with this function: // Function to be used to update the position. Given the current position, // the direction in which the tank is looking...
  15. S

    Confused about Linear Predictive Coding (LPC)

    Hi I'm taking a multimedia systems course and I'm preparing for my exam on tuesday. I'm trying to get my head around LPC compression on a general level, but I'm having trouble with what is going on with the linear predictive filter part. This is my understanding so far: LPC works by...
  16. G

    Comp Sci JAVA CODING - Implementing methods for a game, API

    import acm.graphics.*; import acm.program.*; import java.awt.Color; import java.util.Iterator; import java.util.Random; import java.util.List; public class LAB1 { final static int BLOCKWIDTH = 50; final static int BLOCKHEIGHT = 10; final static int NBLOCKS = 10; final static...
  17. C

    What's the coding job like in oil companies?

    For those who have worked in oil companies or finance companies as coders, are your work over there have more emphasize on algorithm design/analysis or class/library creation/maintenance? Forgive me if this is a stupid question as I don't have much experience in writing codes. And I understand...
  18. D

    Coding Theory : Inequivalent design.

    Construct two inequivalent 2-(16,6,2) designs. Show that they are inequivalent by proving that one cannot obtained from the other by any permutations of the rows or columns of the incidence array or by showing that the codes produced by the span of the rows have different parameters. I have...
  19. R

    Stepping motor coding on microchip

    Hello, Trying to code a microchip PIC18C452. Desired: 4 steps per rotations pulses per second=1/15 t wait =15s #define #define #define #define clrf STEP_ONE b’00100000’ STEP_TWO b’00010000’ STEP_THREE b’00001000’ STEP_FOUR b’00000100’ STEP_NUMBER ; PortB<5:2> are used to connect...
  20. Y

    Hoffman coding in 8bit sequence

    A data file contains a sequence of 8-bit characters such that all 256 characters are about as common: the maximum character frequency is less than twice the minimum character frequency. Prove that Huffman coding in this case is not more efficient than using an ordinary 8-bit fixed-length code...
  21. S

    MATLAB Coding Eigen Solver in Matlab: Jacobi/Lanczos vs Vector Iteration

    I'm to code the Eigen solver in Matlab for a reserach project. The project concerned might also give me complex eigen values. I have been formulating the algorithm for Vector iteration method (or otherwise called the Power method) for the computation of eigen values/eigen vectors. The...
  22. N

    Coding - instilling a subconcious fear

    "coding" - instilling a subconscious fear I just came across this article from 2005 and I found it curious http://www.washingtonpost.com/wp-dyn/content/article/2005/10/01/AR2005100101196.html I don't know a crap about psychology or medicine, so can somebody with knowledge explain if this...
  23. P

    VHDL coding for IDEA Algorithm

    Hi all ... Does anyone knows how to implement IDEA algorithm in VHDL, especially the multiplier part(Low High Algorithm)? Kindly help me out in this
  24. F

    Help with coding my own shell in C, Unix environment

    Homework Statement Need to write my own shell in C for a Programming assignment. It must also support piping, redirection, and appending. Homework Equations The professor provided a preliminary version of the program that supports piping, but not redirection of either input or...
  25. S

    Understand Fortran Coding Do Loop: VBA Translation Help

    Can some1 kindly help me understand the following code, I am trying to translate the following code in VBA: Thanks in advance FFLC = FLC ...i understand this part ANGLE=PI/6 !Suppose 30 Degrees ...i understand this part Do 21800 I=i,5 ...Don't understand this FLC=FFLC-COS(ANGLE)*NDIA...
  26. E

    MATLAB Cut and paste Matlab coding into Latex for equations

    Hi guys, I have to do a lot of equations in a report, and I was wondering if there is a package for Latex so that I can just cut and paste matlab/excel coding straight into Latex and it will set it out properly. i.e. so that instead of typing \frac{5+x}{4} I can just write (5+x)/4?
  27. D

    Quick Python color coding in editing question

    When I've been programming in Python for a while I noticed that the color coding in IDLE goes away. If I restart IDLE, the colors come back. Why is it doing this? How can I maintain the color in there without having to restart a bunch of times? Thanks
  28. T

    Coding, Modulation & the relationship between frequency and data rate

    Hi, This is a general question rather than an explicit question, so apologies for not using the template. I'm a bit confused by the relationship between frequency and data rate in a communications system and wondered if someone could help clarify please. Say I want to achieve a data...
  29. K

    Solve for x: MATLAB Coding Question Homework

    Homework Statement Find x where r varies from 0 to 4. Homework Equations x-(r/4)*sin(pi*x)=0 The Attempt at a Solution The problem that I ran into with MATLAB is that when I create a sub-m file for fsolve, it requires 2 equations whereas I only have 1 equation. function...
  30. C

    Solve Coding Problem with Efficient Wide Boiling Program - Get Help Now!

    please i need help in this code program wide_boiling implicit none integer :: i, j, m real :: Trosee, Tbulle, P, RR(100), vf(100), real :: aT1(3), aT6(3), ap1(3), z(3), ap2(3) real ::, x(3), T, k(3,10) m=0 T=518.67 m=m+1 do i = 1,3 k(i,m) =...
  31. Demon117

    How Many Edges Will Herman Visit Before Reaching the Poison?

    Homework Statement Consider Herman the Fly. Herman must exist on the edges of a cube. At the start of a trial, Herman is randomly placed on one of the eight corners of a cube and poison is placed on one of the eight corners. Herman starts moving along one of the three edges. When he comes...
  32. J

    MATLAB Matlab coding for forward time scheme

    I'm doing my project on generalized eikonal formalism to detect interference phenomena instead of using geometrical phenomena. Now, i have selected numerical method such as lepfrog, forward time centered space, forward-time backward space and forward time forward space to detect that optical...
  33. S

    MATLAB Matlab coding problem (Black-Scholes Option Pricing content)

    So I have made this code to price a european call, hedge, and record the hedging error at each time step. I then take the mean and variance of the hedging error which is suppose to go to zero as dt goes to zero. Here's what I have, my question will follow: clear; %Parameters M = 200; dt =...
  34. T

    Quick help with NCBI and finding coding region

    Homework Statement 5. What is the coding region of the sequence obtained i.e. bases ?? to ?? and what is the name of the gene Homework Equations Sequence A atggcaacaaatatccgaaaaactcacccgctcctta Sequence B catcacctcacttgagaacaaacttctctataaatact The Attempt at a...
  35. C

    Coding theory - binary symmetric channel

    Hi Let us suppose we transmit the binary digit '1'. The probability of not receiving '1' is p. Thus the probability of receiving '1' is 1-p. Suppose we send a longer code of length n. The probability of this code being received correctly is (1-p)^n. Now I don't understand this next...
  36. Y

    MATLAB Matlab Coding Help: Initialize Variables in Pop and Pro

    chromosome = initialize_variables(pop,pro); What is the meaning of this line ? Thank you..
  37. N

    Comp Sci DrJava Coding Lab(Eclipse) (Instance Variable help)

    Homework Statement Lab Tasks 1. Change the definition of the lab3.EcoOne class so that it is in a composition relationship with the example1.Terrarium class. Define a void method named ‘addCaterpillar’ which adds a new example1.Caterpillar to the composed Terrarium, and starts the Caterpillar...
  38. D

    Small Coding Problem for Excel Macro

    I want to code a macro that will take in an integer as a row number and insert two rows above that row. This will repeat in a for loop. The problem is that I'm not familiar with VB syntax. Here's what I have so far: Sub Insert_Rows_Loop() Dim CurrentSheet As Object Dim x As Integer '...
  39. S

    How Do You Write a MIPS Function to Horizontally Flip an Image?

    Homework Statement The goal of this problem is to write a MIPS function flipimage which flips an image horizontally. For example, a simple image is shown on the left, and its flip is shown on the right. A picture is composed of individual dots, or pixels, each of which will be represented...
  40. A

    How to Design a Coding Circuit for a 1994 BMW 325 Ignition Switch?

    hi! everyone, um new to this forum and would like some help and few tips on designing a coding and decoding circuit to replace my car ignition switch with, for now all i know is the basics of logic circuit operations, still not enough to perform the function. can someone help plis!
  41. D

    Coding Language To Sumbit Information To web Browser

    Hi, I was wondering first off, if it is possible to write code so that you could fill out fields in a web browser so that you could automate a process. I'd like to make a script that basically goes online submits my username and password and then fills out 8 hours worked in the appropriate...
  42. Borg

    Worst coding ever - what to do?

    I am currently in the middle of a three month Java programming assignment, working on the worst code I ever thought to see. It looks like it was written by a monkey who was being rewarded by hitting a giant button marked "Copy and Paste". One class file that I'm working on has over 10,000...
  43. G

    Relating Robotics To Mathematics Of Coding

    Hello. I'm currently taking a class at the University of Minnesota, "The Mathematics of Coding Theory". In the class we have a final project on a topic of our choice that relates to the class. The guidelines are very broad and needs to only result in a final report of 10-20 pages answering a...
  44. M

    Stuck on Continue Statement: Solving a Python Coding Problem

    I Have been using A Byte of Python, and I am now stuck on the Continue Statement. Here is my code. #!/usr/bin/python #Filename: continue1.py while True: s = input('Enter something : ') if s == 'quit': break if len(s) < 3: print('Too Small') continue print('Input is of...
  45. L

    PIC16F877, sample coding regarding the use of switch

    Homework Statement I'm learning PIC recently. Below is the coding that i have prepared and the attachment is the connection that I used. My question is, why the 2 LEDs will on immediately once i trigger the PIC? This is because the result is not something that should be coming out. What's...
  46. P

    LaTeX Where is the Latex Coding Thread?

    i've been away more than 5 yrs and can't find the thread that used to tell you how to code latex. you could practise there too without burdening others with your errors. where is that thread? or something similar? in friendship, prad
  47. J

    Coding a Solution to an Ugly Character Mess

    Hello! I am working on some software to control oscilloscopes and function generators in a physics lab. The situation I am faced with at the moment is to be able to translate integers into a form which can be loaded into a device. So basically I have a file which looks like this...
  48. C

    Coding Theory, Finding Dual Code

    Homework Statement Let S = {0101, 1010, 1100}. From first principles, find a basis B for the dual code C orthogonal (couldn't find symbol) Homework Equations http://www.maths.uq.edu.au/courses/MATH3302/files/codingnotes.pdf i'm using page 19,20 and 21 The Attempt at a Solution...
  49. M

    A little notation help, on quantum coding

    Hi, I wanted to know how to solve this question , its not a homework question i am really asking for , more the general way to solve these types of questions... I don't understand how it forms into another matrix. I have the answer attached as well , but could some one explain ? (I don't think...
  50. P

    IFORT Coding Problem (Simpson's Rule)

    Homework Statement For a function f(x) over the interval [a,b], simpson's rule approximates the defenite integral:\intf(x) dx = h/3*[f0 + 4(f1 + f3+ ...+ f2n-1) + 2(f2 + f4 + ... + f2n-2) + f2n] where h = (b-a)/n fi is f(a + i*h) Given an error epsilon, I need to write an executable program...
Back
Top