Hi, I was wondering if anyone knew of a chemical that trap odour?
The idea is to design cat-litter using perlite as the main ingredient however; as perlite doesn't have 'odour-trapping' properties I was hoping to mix it with another chemical...
Thanks...
Homework Statement
5. What is the coding region of the sequence obtained i.e. bases ?? to ?? and what is the name of the gene
Homework Equations
Sequence A
atggcaacaaatatccgaaaaactcacccgctcctta
Sequence B
catcacctcacttgagaacaaacttctctataaatact
The Attempt at a...
Hey, this is a multiple choice with a explanation as to which enzyme is unsuitable as a marker enzyme, and i actually have no idea!
a. Glutamate dehydrogenase
b. Cytidylyl transferase
c. Succinate dehydrogenase
d. Acid phosphatase
e. Malate dehyrogenase
f. Citrate synthase
g...
Granted his word may carry more weight due to his line of work, however, without video recording of the incident surely such a charge cannot be processed. I'm only speculating if this were to happen, since I intend to argue with the domestic guys this weekend. However like I said I'm not 100%...
They don't give you an on the dot fine, instead they take the evidence away and find a way to convict you then issue a fine, however I don't think I was clear, the litter is at a designated area where only on Sundays (the day of the incident) littering at that point is forbidden, all I'm really...
Hi, I have a bit of a situation, hence require some knowledge with regards to the matter.
As far as I'm aware eyewitness testimony's don't stand in court even if said witness was an authorized law enforcement you'd need hard evidence to prosecute, i.e. video record, DNA etc.
However, in...
Hi there, sorry this question may already have been answered, several times. I tried to use the search function but couldn't come across such a thread.
Long story short, I was wondering what you think of the future in Genetics? I'd imagine each embryo will be genetically modified perhaps to...
Right so, increasing the concentration of the HCl (aq) solution will increase the H+ ions available..:S
But my main query is..
Does the HCl split up to form H+ and Cl- ions which then react with the Mg to form MgCl2, if so what causes this separation to occur.. Is it simply becuase 'Mg wants...
Thanks for a quick reply..
A magnesium strip will be put into an (aq) HCl at different concentration levels.. The higher the concentration the faster the rate of decomposition.. but I cannot justify why.. :S
Hi..
Im trying to figure out what the affect of HCl on a magnesium strip at different concentration levels has? I can't figure out a 'scientific' response and therefore can't formulate a hypothesis :/ Any help will be appreciated.
Hey.. Sorry to be so dopey but I'm unable to write a valid hypothesis about the solubility of KNO3 in water as temperature increases...
I'm unsure which laws apply and how to write up a decent standard hypothesis.. could you possibly give me a few key terms I could research or write a few...
1. 'Find an expression in terms of x for the variance of: 9,4,x,3'
Give your answer in the form of ax^2 + bx + c
I would usually give you some information of how I could possibly tackle this question but unfortunately I have no idea. Could someone shed some light? Thanks
What are the basic principles behind oscillating reactions, I mean, if its known as 'chemical magic' what must it undergo to be such a thing?
I've been looking all over the web and havn't been able to find enough information, for example, how the laws of thermodynamics are broken or how it...